case study for biology project class 12

Biology 30 case study project

Recommended

More Related Content

What's hot.

What's hot ( 20 )

Viewers also liked

Viewers also liked ( 7 )

Similar to Biology 30 case study project

Similar to Biology 30 case study project ( 20 )

More from mmhth

More from mmhth ( 9 )

Recently uploaded

Recently uploaded ( 20 )

• 1. Biology 30 Case Study Project

• Andhra Pradesh
• Chhattisgarh
• West Bengal
• Madhya Pradesh
• Maharashtra
• Jammu & Kashmir
• NCERT Books 2022-23
• NCERT Solutions
• NCERT Notes
• NCERT Exemplar Books
• NCERT Exemplar Solution
• States UT Book
• School Kits & Lab Manual
• NCERT Books 2021-22
• NCERT Books 2020-21
• NCERT Book 2019-2020
• NCERT Book 2015-2016
• RD Sharma Solution
• TS Grewal Solution
• DK Goel Solution
• TR Jain Solution
• Selina Solution
• Frank Solution
• ML Aggarwal Solution
• Lakhmir Singh and Manjit Kaur Solution
• I.E.Irodov solutions
• ICSE - Goyal Brothers Park
• ICSE - Dorothy M. Noronhe
• Sandeep Garg Textbook Solution
• Micheal Vaz Solution
• S.S. Krotov Solution
• Evergreen Science
• KC Sinha Solution
• ICSE - ISC Jayanti Sengupta, Oxford
• ICSE Focus on History
• ICSE GeoGraphy Voyage
• ICSE Hindi Solution
• ICSE Treasure Trove Solution
• Thomas & Finney Solution
• SL Loney Solution
• SB Mathur Solution
• P Bahadur Solution
• Narendra Awasthi Solution
• MS Chauhan Solution
• LA Sena Solution
• Integral Calculus Amit Agarwal Solution
• IA Maron Solution
• Hall & Knight Solution
• Errorless Solution
• Pradeep's KL Gogia Solution
• OP Tandon Solutions
• Sample Papers
• Previous Year Question Paper
• Value Based Questions
• CBSE Syllabus
• CBSE MCQs PDF
• Assertion & Reason
• New Revision Notes
• Revision Notes
• HOTS Question
• Marks Wise Question
• Toppers Answer Sheets
• Exam Paper Aalysis
• Concept Map
• CBSE Text Book
• Additional Practice Questions
• Vocational Book
• CBSE - Concept
• KVS NCERT CBSE Worksheets
• Formula Class Wise
• Formula Chapter Wise
• Crash Course
• Previous Year Paper
• Important Info
• Previous Year Papers
• Quantitative Aptitude
• Numerical Aptitude Data Interpretation
• General Knowledge
• Mathematics
• Agriculture
• Accountancy
• Business Studies
• Political science
• Enviromental Studies
• Mass Media Communication
• Teaching Aptitude
• NAVODAYA VIDYALAYA
• SAINIK SCHOOL (AISSEE)
• Mechanical Engineering
• Electrical Engineering
• Electronics & Communication Engineering
• Civil Engineering
• Computer Science Engineering
• CBSE Board News
• Scholarship Olympiad
• School Admissions
• Entrance Exams
• All Board Updates
• Miscellaneous
• State Wise Books
• Engineering Exam

Biology Case Study for Class 12 (Download Free PDF)

Free pdf download.

SHARING IS CARING If our Website helped you a little, then kindly spread our voice using Social Networks. Spread our word to your readers, friends, teachers, students & all those close ones who deserve to know what you know now.

Biology Case Study for Class 12

While preparing for the board exams, students are being judged on different levels of skills, such as writing, reading, etc. Biology Case Study for Class 12 questions are one of them that helps in assessing critical thinking.

The Central Board of Secondary Education will be asking the case study questions in the Class 12 board examination. Therefore, here on this page, we have provided the Biology Case Study for Class 12 at free of cost. Our subject matter experts have prepared Case Study questions so that Apart from the basic standard questions, students can have a variety of problems to solve. 

Just like MCQs, and other written types questions Biology Case Study for Class 12 questions will impact the overall performance of a student. Therefore for the convenience of the students we have provided the download links here, so that they can easily access the Class 12 Case Study.

Download Chapter Wise Biology Case Study for Class 12 Question and Answers PDF 

There are lots of chapters in class 12 Biology from which Class 12 Case Study Questions can be framed. Going through such types of questions help the students to assess their understanding level in the topics discussed in NCERT Class 12 Biology Books. By practicing the Class 12 Case Study Questions for Biology students will be very confident to ace the board exam. Also the Biology case study will be very useful for the NEET exam preparation.

Doing a regular practice of Class 12 Biology Case Study questions is a great way to score higher marks in the board exams as it will help students to develop a grip on the concepts. 

Here our subject experts have crafted the Subject Wise Case Study For Class 12. Download Subject Wise CBSE Case Study Class 12 Question and Answers PDF from the below given links.

Case Study Questions Class 12 Chapter 2 Sexual Reproduction in Flowering Plants

Case Study Questions Class 12 Chapter 3 Human Reproduction

Case Study Questions Class 12 Chapter 4 Reproductive Health

Case Study Questions Class 12 Chapter 5 Principles of Inheritance & Variation

Case Study Questions Class 12 Chapter 6 Molecular Basic of Inheritance

Case Study Questions Class 12 Chapter 8 Human Health And Diseases

Case Study Questions Class 12 Chapter 10 Microbes in Human Welfare

Case Study Questions Class 12 Chapter 11 Biotechnology - Principles & Processes

Case Study Questions Class 12 Chapter 12 Biotechnology And Its Applications

Case Study Questions Class 12 Chapter 13 Organisms And Populations

Case Study Questions Class 12 Chapter 15 Biodiversity And Conversation

Case study types of questions are generally descriptive that helps to gather more information easily so, it is kinda easy to answer. However, our subject matter experts have given the solutions of all the Biology Case Study for Class 12 Biology questions.

Passage Based Class 12 Biology Case Study Questions in PDF

CBSE Class 12 Case studies are known as Passage Based Questions. These types of problems usually contain a short/long paragraph with 4 to 5 questions. 

Students can easily solve Passage Based Class 12 Case Study Questions by reading those passages. By reading the passage students will get the exact idea of what should be the answers. Because the passage already contains some vital information or data. However a better understanding of the basic concepts that can be learned from the NCERT Class 12 Textbooks will aid in solving the Case based questions or passage based questions.

How to Download CBSE Case Study of Class 12 Biology ?

Follow the below given simple steps to know how to download CBSE Case Study of Class 12 Biology:-

• Open Selfstudys website in your browser
• Go to the navigation menu that look like this
• Now, click on CBSE and then Case Study respectively
• A new page will open, where you have to click on “Class 12”
• Now, you are ready to select the subject for which you want to download the case study questions.

How to Solve Biology Case Study Based Questions of Class 12?

There are very simple methods that a student should keep in mind while solving Biology Case Study for Class 12 for any subject:

• Read each line of paragraph carefully and pay attention to the given data/numbers. Often questions are framed according to the highlighted data of the passage.
• Since case study questions are often framed in Multiple choice questions, students should have the knowledge of elimination methods in MCQs.
• Having a good understanding of the topics that are discussed in CBSE Class 12 Books are ideal to Solve Case Study Based Questions of Class 12.

Features Of Class 12 Biology Case Study Questions And Answers PDF

The three most noticeable features of Class 12 Biology Case Study Questions And Answers Pdf are -

• It Is Free To Use:  Keeping in mind the need of students and to help them in doing Self Study, our team has made all the PDF of Biology Case Study for Class 12 free of cost.
• Answers Are Given:  Not only the PDFs are free provided but answers are given for all the questions of Biology Case Study for Class 12. 
• PDF Can Be Downloaded Or Viewed Online:  Many students don’t like to download the PDFs on their device due to the shortage of storage. Therefore, CBSE Class 12 Case Study questions are made available here in online format, so that students can view them online. However, through the Selfstudys app, a learner can download the PDFs too.

Benefits of Using CBSE Class 12 Biology Case Study Questions and Answers

The CBSE Class 12 Biology Case Study Questions and Answers can help a student in several ways:

• In Exam Preparation:  Those who go through the Biology Case Study for Class 12 will find support during the exam preparation as case based questions are also asked in the CBSE Class 12 Board examination. 
• Help in brushing up the previous learnings:  No matter how brilliant you are, you have to revise the studied topics time and again to keep them refreshed. And in this task, the CBSE Class 12 Case Study Questions and Answers can help a lot.
• To develop the critical thinking:  Able to analyse information and make an objective judgement is a skill that is known as critical thinking. A student of class 12 can use Biology Case Study for Class 12 with answers to develop critical thinking so that they can make better decisions in their life and in the board examination.
• NCERT Solutions for Class 12 Maths
• NCERT Solutions for Class 10 Maths
• CBSE Syllabus 2023-24
• Social Media Channels
• Login Customize Your Notification Preferences

• Second click on the toggle icon

• School & Boards
• College Admission
• Govt Jobs Alert & Prep
• Current Affairs
• GK & Aptitude

Case Study Based Questions for CBSE Class 12 Biology Board Exam 2023: Read this article for Last Minute Revision

Cbse class 12 biology important case study questions: practise important case study based questions for class 12 biology board exam. these case study based questions are important for the upcoming cbse class 12 biology board exam 2023 on march 16, 2023..

CBSE Class 12th Biology Board Exam 2022-23 Pattern

Cbse class 12 biology important case study based questions.

• It is the presence of an extra chromosome in a diploid cell.
• An aneuploid cell differs from other cells only in size.
• It can be less number of chromosomes in a diploid cell.
• Aneuploidy always affects female individuals.
• both i and iii
• both ii and iii
• i, iii and iv
• Errors in meiosis I is the only cause of aneuploidy
• Aneuploidy always affects sex chromosomes.
• Most of the aneuploidy results from errors in cell division involved in egg formation.
• Nondisjunction in meiosis I can lead to more abnormal cells than disjunction in meiosis II.
• both I and iii
• both iii and iv
• I, iii and iv
• Aneuploidy is not influenced by the mother’s age.
• Delivery before 30 years of age can decrease the incidence of aneuploidy in most cases
• The chance of aneuploidy increases up to 22 years of age.
• There is a dramatic increase in aneuploidy if the maternal age exceeds 30

• both ii and iv
• Chromosomal disorders
• Mendelian disorders
• Incomplete dominance
• All the above
• Both assertion and reason are correct and the reason is the correct explanation of assertion
• Both assertion and reason are correct but the reason is not the correct explanation of the assertion
• Assertion is correct but the reason is incorrect
• Both assertion and reason are incorrect

• Biotechnology
• Biomonitoring
• Bioinformatics
• Biosystematics
• Identify disease-causing genes in humans
• Can be used to understand the molecular mechanisms of sequence evolution.
• Human genome contains 3164.7 million bp.
• Average gene consists of 3000 bases, but sizes vary greatly.
• Almost all (99.9 percent) nucleotide bases are exactly the same in all people.
• Less than 2 percent of the genome codes for proteins.

• A radioactively labelled double stranded RNA molecule.
• A radioactively labelled double stranded DNA molecule.
• A radioactively labelled single stranded DNA molecule.
• A radioactively labelled single stranded RNA molecule.
• DNA isolation
• DNA digestion with restriction enzymes.
• DNA fragment separation by electrophoresis.
• Hybridization
• DNA visualization under UV light.
• By exhaling droplets of a non-infected person.
• By headache or leg pain.
• By eating fast food.
• By inhaling droplets of an infected person.
• A continuous culture system
• A stirred-tank bioreactor without in-lets and out-lets
• Laboratory flask of the largest capacity
• None of the above
• upstream processing
• downstream processing
• bioprocessing
• postproduction processing
• Human insulin
• Growth hormone
• cleaving and joining of DNA segments with endonuclease
• cleaving DNA segments with endonuclease and re-joining with ligase
• cleaving and re-joining DNA segments with ligase
• cleaving DNA segments with ligase and re-joining with endonuclease

• Replacing a disease-causing gene with a healthy copy of the gene
• Inactivating a disease-causing gene that is not functioning properly
• Introducing a new or modified gene into the body to help treat a disease
• Adenosine deaminase
• phenylketonuria
• Phenylalanine
• Bone marrow transplantation
• Southern blotting
• acute diseases
• physiological diseases
• hereditary diseases
• infectious diseases

Get here latest School , CBSE and Government Jobs notification in English and Hindi for Sarkari Naukari and Sarkari Result . Download the Jagran Josh Sarkari Naukri App .

• CBSE Board exam 2023 result date. + As per the guidelines released by the Central Board of Secondary Education (CBSE), the tentative dates for the CBSE Board Exam 2023 results are; for class 10th: 15th April 2023 and for class 12th: 30th April 2023.
• When is the Class 12th Biology CBSE Board exam? + According to the date sheet released by the Central Board of Secondary Education (CBSE) for class 12th, the Biology exam is scheduled for the 16th of March 2023. The day will be Thursday.
• SAIL Recruitment 2023
• WBPSC WBCS Admit Card 2023
• Calicut University Result 2023
• BPSC TRE Admit Card 2023
• Bihar Police SI Admit Card 2023

Related Stories

CBSE Class 12 Political Science Exam Pattern 2024 with Marking Scheme and Topic-wise Weightage

CBSE Class 12 Hindi Exam Pattern 2024 with Marking Scheme and Topic-wise Weightage

CBSE Class 12 Biology Exam Pattern 2024 with Marking Scheme and Topic-wise Weightage

Trending Categories

• Education News
• CBSE Class 10

Latest Education News

UPPSC Recruitment 2023: Apply Online For Staff Nurses Posts, Check Eligibility And Application Process

Tamil Nadu NMMS 2024 Registrations Commcence, Get Direct Link Here

Mizoram Assembly Election Results 2023: Full Winners Constituency, Party and Seat wise

Brain Teaser For IQ Test: Can You Spot The ODD Cougar in The Picture Within 9 Seconds?

Puzzle for IQ Test: Can You Help This Man Find The Safest Exit Within 21 Seconds?

Optical Illusion For IQ Test: Only 1% Can Spot the Turtle Hidden Between The Lily Pads In The Picture Within 21 secs!

Chennai School News Tomorrow: Will Schools in Chennai be Closed Tomorrow? Check Updates Here

UGC NET December 2023 Exam Last Minute Tips: NTA NET Quick Preparation Strategy to Ace Paper 1, Paper 2

Only excellent observers can spot the shepherd’s hidden brother in 6 seconds.

The Indian Navy Quiz: GK Question & Answer On The Sea Warriors Of India

Name Of Countries That Start With The Letter X; Check List Here

List of Red And Blue States 2023 in the US

क्या है साइबर क्राइम का नया तरीका 'डिजिटल अरेस्ट'? जानें

Indian Navy Day: भारतीय नौसेना की सही रैंक, प्रतीक चिन्ह ओर बैज के बारें में यहां जानें

Delhi Police Constable Answer Key 2023: कांस्टेबल परीक्षा की उत्तर कुंजी ssc.nic.in पर जल्द, यहां चेक करें अपडेट

Today’s Wordle 486: October 18 Clues and Answers

Class 10 Maths NCERT Solutions Chapter 7 Coordinate Geometry - Exercise 7.2

CLAT Answer Key 2024 Link Deactivated, Check Details Here

Class 12 Biology Case Study Based Questions PDF Download

• Post author: studyrate
• Post published:
• Post category: Class 12 / 12 board
• Post comments: 0 Comments

In the pursuit of academic excellence, Class 12 Biology students often encounter case studies that challenge their problem-solving abilities and critical thinking skills. These case studies serve as valuable learning tools, allowing students to apply their theoretical knowledge to real-life scenarios. In this article, we will delve into the significance of Class 12 Biology Case Study Based Questions and provide a downloadable PDF resource containing a collection of such questions. So, let’s explore how these case studies can enhance students’ understanding and performance in the subject.

Case study-based questions simulate real-life situations, encouraging students to analyze, evaluate, and apply their knowledge to address specific problems. By engaging with these scenarios, students develop a deeper understanding of the subject matter, making their learning more meaningful and relevant.

Table of Contents

Case Study-Based Questions for Class 12 Biology

These Class 12th Case Study and Passage-Based Questions will help you to score 95% in Your Board Exams.

• Class 12 Physics Case Study Questions
• Class 12 Chemistry Case Study Questions
• Class 12 Biology Case Study Questions
• Class 12 Maths Case Study Questions

Books for Class 12 Biology

Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2024 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2024 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2024. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.

Case Study-Based Questions Benefit Class 12 Biology Students

Comprehensive learning.

By incorporating case studies into the curriculum, Class 12 Biology students gain a comprehensive understanding of complex biological concepts. These case studies encompass a wide range of topics, from ecology to genetics, and offer multifaceted learning experiences.

Application of Theoretical Knowledge

Theoretical knowledge becomes more valuable when students can apply it practically. Case study-based questions bridge the gap between theory and application, empowering students to connect classroom learning to real-world situations.

Engaging and Interactive Learning

Case studies have an inherent appeal, as they present intriguing problems that captivate students’ attention. This engagement enhances their motivation to learn, making the subject more enjoyable and meaningful.

Tips for Effective Utilization of Case Study-Based Questions

Collaborative learning.

Encourage students to discuss case studies in groups. Collaborative learning promotes teamwork, diverse perspectives, and a deeper understanding of the subject matter.

Teacher Guidance

Teachers play a crucial role in guiding students through the analysis of case studies. Providing insights, posing relevant questions, and facilitating discussions can significantly enhance the learning experience.

Regular Practice

Integrate case study-based questions into regular assessments. Regular practice helps students become more comfortable with this format and boosts their confidence in tackling complex problems.

Class 12 Biology Syllabus for 2024

Check the complete syllabus below along with the new exam scheme. 

Detailed Syllabus:

Unit-VI Reproduction

Chapter- 2:   Sexual Reproduction in Flowering Plants

Flower structure; development of male and female gametophytes; pollination – types, agencies and examples; out breeding devices; pollen-pistil interaction; double fertilization; post-fertilization events – development of endosperm and embryo, development of seed and formation of fruit; special modes- apomixis, parthenocarpy, polyembryony; Significance of seed dispersal and fruit formation.

Chapter- 3: Human Reproduction

Male and female reproductive systems; microscopic anatomy of testis and ovary; gametogenesis-spermatogenesis and oogenesis; menstrual cycle; fertilisation, embryo development up to blastocyst formation, implantation; pregnancy and placenta formation (Elementary idea); parturition (elementary idea); lactation (elementary idea).

Chapter- 4: Reproductive Health

Need for reproductive health and prevention of Sexually Transmitted Diseases (STDs); birth control – need and methods, contraception and medical termination of pregnancy (MTP); amniocentesis; infertility and assisted reproductive technologies – IVF, ZIFT, GIFT (Elementary idea for general awareness).

Unit-VII Genetics and Evolution

Chapter-5: Principles of Inheritance and Variation

Heredity and variation: Mendelian inheritance; deviations from Mendelism – incomplete

dominance, co-dominance, multiple alleles and inheritance of blood groups, pleiotropy; elementary idea of polygenic inheritance; chromosome theory of inheritance; chromosomes and genes; Sex determination – in humans, birds and honey bees; linkage and crossing over; sex-linked inheritance – haemophilia, colour blindness; Mendelian disorders in humans – thalassemia; chromosomal disorders in humans; Down’s syndrome, Turner’s and Klinefelter’s syndromes.

Chapter-6: Molecular Basis of Inheritance

Search for genetic material and DNA as genetic material; Structure of DNA and RNA; DNA packaging; DNA replication; Central Dogma; transcription, genetic code, translation; gene expression and regulation – lac operon; Genome, Human and rice genome projects; DNA fingerprinting.

Chapter-7: Evolution

Origin of life; biological evolution and evidence for biological evolution (paleontology, comparative anatomy, embryology, and molecular evidence); Darwin’s contribution, modern synthetic theory of evolution; mechanism of evolution – variation (mutation and recombination) and natural selection with examples, types of natural selection; Gene flow and genetic drift; Hardy – Weinberg’s principle; adaptive radiation; human evolution.

Unit-VIII Biology and Human Welfare

Chapter-8: Human Health and Diseases

Pathogens; parasites causing human diseases (malaria, dengue, chikungunya, filariasis, ascariasis, typhoid, pneumonia, common cold, amoebiasis, ring worm) and their control; Basic concepts of immunology – vaccines; cancer, HIV and AIDS; Adolescence – drug and alcohol abuse.

Chapter-10: Microbes in Human Welfare

Microbes in food processing, industrial production, sewage treatment, energy generation and microbes as bio-control agents and bio-fertilizers. Antibiotics; production and judicious use.

Unit-IX Biotechnology and its Applications

Chapter-11: Biotechnology  – Principles and Processes

Genetic Engineering (Recombinant DNA Technology).

Chapter-12: Biotechnology and its Applications

Application of biotechnology in health and agriculture: Human insulin and vaccine production, stem cell technology, gene therapy; genetically modified organisms – Bt crops; transgenic animals; biosafety issues, biopiracy and patents.

Unit-X Ecology and Environment

Chapter-13: Organisms and Populations

Population interactions – mutualism, competition, predation, parasitism; population attributes – growth, birth rate and death rate, age distribution. (Topics excluded: Organism and its Environment, Major Abiotic Factors, Responses to Abiotic Factors, Adaptations)

Chapter-14: Ecosystem

Ecosystems:  Patterns, components; productivity and decomposition; energy flow; pyramids of number, biomass, energy (Topics excluded: Ecological Succession and Nutrient Cycles)

Chapter-15: Biodiversity and its Conservation

Biodiversity-Concept, patterns, importance; loss of biodiversity; biodiversity conservation; hotspots, endangered organisms, extinction, Red Data Book, Sacred Groves, biosphere reserves, national parks, wildlife, sanctuaries and Ramsar sites.

Case study-based questions are invaluable tools that enrich the learning experience of Class 12 Biology students. They foster critical thinking, decision-making skills, and the practical application of theoretical knowledge. By engaging with case studies, students develop a deeper understanding of biological concepts and their relevance in the real world.

Are the case study-based questions suitable for self-study?

Absolutely! These case study-based questions are designed for both classroom learning and self-study. They are excellent resources for independent practice.

Where I can get Class 12th Biology Case Study Questions?

You can practice the Biology Class 12th Case Study Questions on studyrate.in for free.

Do the case studies cover the entire Class 12 Biology syllabus?

Yes, the case studies encompass various topics from the Class 12 Biology syllabus, providing comprehensive coverage.

Are answer keys provided for the case study-based questions?

Yes, after every questions the Ansswer is provided with detailed explanation

You Might Also Like

Mcq questions class 12 economics chapter 6 open-economy macroeconomics with answers, mcq class 12 english keeping quiet questions with answers english poem 3, disha 1700+ objective question bank of biology pdf download, leave a reply cancel reply.

Save my name, email, and website in this browser for the next time I comment.

This site uses Akismet to reduce spam. Learn how your comment data is processed .

Download India's best Exam Preparation App Now.

Key Features

• Revision Notes
• Important Questions
• Previous Years Questions
• Case-Based Questions
• Assertion and Reason Questions

No thanks, I’m not interested!

• Video Lectures
• Live Sessions
• Study Materials 
• Previous Year Papers
• Revision                                                                                                                                                                   

myCBSEguide

• Class 12 Biology Case...

Class 12 Biology Case Study Questions

Table of Contents

myCBSEguide App

Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.

• Case Studies with objective questions
• Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

• What is the objective of this action?
• Explain how the gene of interest is introduced into a vector.
• You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
• A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

• progesterone
• luteinizing hormone
• follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

• Peak of Hormone B will be observed at a higher point in the graph
• Peak of Hormone B will be observed at a point lower than what is given in the graph
• There will be no observed data for Hormone B
• The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

• Corpus Luteum
• Tertiary follicle
• Graafian follicle
• Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

Which of the following statements is true about the subjects?

• Subject 1 is pregnant
• Subject 2 is pregnant
• Both subject 1 and 2 are pregnant
• Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes.  ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

• Penicillium notatum
• Saccharomyces cerevisiae
• Aspergillus niger
• Clostridium butylicum
• thermal vents
• polluted water
• all of these
• None of the above
• production of a large amount of CO 2
• production of O 2
• due to the presence of water
• none of these
• Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
• Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
• Our Assertion is true but the Reason is false
• Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.

Test Generator

Create question paper PDF and online tests with your own name & logo in minutes.

Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes

Related Posts

• Competency Based Learning in CBSE Schools
• Class 11 Physical Education Case Study Questions
• Class 11 Sociology Case Study Questions
• Class 12 Applied Mathematics Case Study Questions
• Class 11 Applied Mathematics Case Study Questions
• Class 11 Mathematics Case Study Questions
• Class 11 Biology Case Study Questions
• Class 12 Physical Education Case Study Questions

Leave a Comment

Save my name, email, and website in this browser for the next time I comment.

We use cookies to enhance our website for you. Proceed if you agree to this policy or learn more about it.

• Essay Database >
• Essays Samples >
• Essay Types >
• Case Study Example

Biology Case Studies Samples For Students

29 samples of this type

Over the course of studying in college, you will inevitably need to compose a bunch of Case Studies on Biology. Lucky you if linking words together and turning them into relevant content comes easy to you; if it's not the case, you can save the day by finding an already written Biology Case Study example and using it as a model to follow.

This is when you will definitely find WowEssays' free samples catalog extremely useful as it contains numerous skillfully written works on most various Biology Case Studies topics. Ideally, you should be able to find a piece that meets your requirements and use it as a template to compose your own Case Study. Alternatively, our competent essay writers can deliver you a unique Biology Case Study model crafted from scratch according to your personal instructions.

Computer Security/ Biometrics Tech, User Authentication, Biological Identity And Case Study Examples

Finding the correct balance between security, cost effectiveness and ease of use presents a major headache for the Metropolitan Police Service (MPS). This is because maintaining a large workforce and clerical staff for the purposes of managing database and internal systems can be a costly practice. MPS staff also require different log in details for the different accounts they hold in different job roles. This paper examines different approaches such as Enterprise Identity Mapping (EIM), Public Key Infrastructure (PKI) and RSA encryption and how they may be utilized in the MPS context.

Borderline Personality Disorder Case Study Sample

Chemical, biological, radiological, and nuclear (cbrn agents) case study samples.

Don't waste your time searching for a sample.

Get your case study done by professional writers!

Just from $10/page

Biology Of Disease Case Studies Examples

Biology of disease, sample case study on the problems of boys dont cry from queer and feminist perspectives, good casey: a major depressive disorder case study example, relevant demographic information case studies example, issues in psychology: hypothetical case study in two-stage life development, free case study on the gender binary in boys dont cry, example of case study on genetics question: is there any family history of mental illness, preliminary investigation case study examples, investigating a crime scene, child protection-child abuse, neglect, and case planning case study example, northern university.

Respectfully Submitted to: Type Month and Year

Free Talent Identification Case Study Example

Introduction, evaluation of scientific knowledge regarding the conservation of the kokako species case study example, good example of project title case study.

H.R. 1412, the Justice and Integrity Act of 2009

H.R. 1412, the Justice and Integrity Act of 2009 A Report from Rep. Steve Cohen (d-tenn.), Discussing Racial Disparities in the Criminal Justice System That He Can Use To Move This Bill Forward in Congress

Free Case Study On Bayer AG: Anthrax And Cipro

Discussion of the case, free case study on mental health, mental health.

Introduction One of the main branches of psychology is mental assessment. This part of psychology calls for numerous observations and ability to relate a certain behavior or response to a set of responses to comprehensively understand the mental status of a person (http://yalepress.yale.edu/yupbooks/excerpts/hicks_50.pdf).

It usually involves careful observation of any possible or visible cue that might give a clue to the mental status a person, a lot of careful questioning and taking of notes as well as mental history of the person under observation. It also calls for human behavior understanding and causes of the various types of mental ailments (http://yalepress.yale.edu/yupbooks/excerpts/hicks_50.pdf).

Assessment procedure

Expertly crafted case study on adaptations of animals that plants lack., discussion board 5, alcoholism a complex disorder: free sample case study to follow.

(Insert Institution)

Alcoholism a Complex Disorder

Free juvenile delinquency case study sample, free case study on the aging process, good example of case study on alternative work schedule, drug and alcohol addiction case studies example, sample case study on system architecture of a compound light microscope, rule case study example, business law case study - case no. 112,063.

Issues 1.Was the appellee entitled to a reimbursement of the maintenance costs he had paid to the children welfare? 2.Did the trial court have the authority to modify an administrative order?

Oklahoma Laws provides that a trial court has the authority to amend an order that it has made if new fats that warrant its amendment are discovered during the hearing of the case.

Application

Jeffrey dahmer case study samples.

The topic of the paper is murder, and its mission is to discuss the crimes of Jeffrey Dahmer and relating this crime with the three categories of crime causation. Murder is the deliberate taking of another person life. Murder can be first-degree and second-degree murder where in the first degree both the intention and the killing is planned (Brown et al, 2010). This paper will also discuss how Jeffery Dahmer killed people deliberately out of ill will.

Good Example Of Osteoporosis Case Study

Case study on john bio psychosocial profile 4, psychology: case study.

Introduction 3

Initial interview 4 Assessment formulation methods utilized 4 Assessment of John presenting problems and goals 5 Analysis and critique of MMT approach 6 Agreed goals 6 Treatment plan 6 CBT interventions 7 Intervention for cognitions-thoughts records 7 Benefits of the approach 7 Interventions for behavior- activity scheduling/diversion techniques 8 Benefits of the approach/ interaction 8 Interventions for imagery/interpersonal- imagery based exposure 8 Benefit of approach 9 Intervention for sensation- relaxation/ visualization 10 Conclusion 11

APPENDIX 1 13

The key issues case study sample.

There are many issues surrounding the life of Marci, the 23 year old young woman that seems to be losing her mind because of perceived indulgence into drugs. Among the primary issues surrounding the life of Marci, the young woman, are such things as:

List in order of importance

Dora's case study example.

Password recovery email has been sent to [email protected]

Use your new password to log in

You are not register!

By clicking Register, you agree to our Terms of Service and that you have read our Privacy Policy .

Now you can download documents directly to your device!

Check your email! An email with your password has already been sent to you! Now you can download documents directly to your device.

or Use the QR code to Save this Paper to Your Phone

The sample is NOT original!

Short on a deadline?

Don't waste time. Get help with 11% off using code - GETWOWED

No, thanks! I'm fine with missing my deadline